Identity of the common bristlenose catfish

[Mike_Noren]

COI is Cytochrome c Oxidase Subunit I, it's the most commonly used gene for barcoding (species identification).

[Shane]

I am not sure what you are basing this statement on. I have managed to find 14 documented cases of "hybridization" in the family. Only ONE of these is a documented case of hybridization between two described spp (Pseudacanthicus leopardus X Pseudacanthicus spinosus). Of the remaining 13 cases, eight (61%) are between Hypancistrus, one Pseudacanthicus, one Leporacanthicus, and one Ancistrus. There are about 95 genera in loricariidae! So out of over 1,000 described spp, 500 plus L and LDA Numbers, and several hundred more known but undescribed spp we have possible hybridization on a baker's dozen of occasions between three of the family's 95 genera. Take out Hypancistrus (which appears to be a huge exception) and you are better off buying a lottery ticket than betting on two loricariids to hybridize.

Err, so you are happy with the assumption that out of the genera of loricariids that have not been spawned in the aquarium that 100% of them will not hybridise? If not, then your logic is a wee bit flawed. On documented cases, you are missing Pterygoplichthys and

Panaque

(see LH numbers). I have also seen Peckoltia,

Rineloricaria

,

Hemiloricaria

and

Sturisoma

hybrids. I am saying that, out of the commonly spawned hypostomine loricariid genera, most are known to hybridise. Your leap of logic is to say that the ones that don't or haven't been spawned don't hybridise. I would also suggest that the creators of hybrids don't exactly rush (or are typically inclined) to document them.

You avoid answering my question on the source of your Ancistrus.

Jools

[Bijn]

I have managed to find 14 documented cases of "hybridization" in the family.

Isn't it possible that this number is so low because most of the hybrids (if they exist) are bred by people who think they are breeding with fish from the same species?

Some people can't see the difference between a P. gibbiceps and a bristelnose, do you think that they would write an article when two different bristelnoses breed in their tank?

So the facts we have are:
1) hybridization is very rare among Ancistrus,

Can you use what you want to prove as proof?

2) limited barcoding shows the common Ancistrus to be evolved from a single lineage

I'm not an DNA-specialist but I thougt maternal DNA was used. So there is no prove there was never a male from another species involved.
In the catelog it is clearly stated that the original L144 was a male.

the line breeding of genetic mutations is most easily accomplished within a small gene pool from the same sp.

This is not true. The chance a mutation pops up is bigger when you inbreed (pure or hybrid, that doesn't matter) but fixing a mutation is always accomplished by line breeding and line breeding happens by definition within a small gene pool, hybrid or not.

The presence of some mutations is no proof for a pure species. Take a look at Xiphophorus.

[Bijn]

It think Jools made a little mistake with his magic tricks.

[Jools]

It think Jools made a little mistake with his magic tricks.

Whoops, sorry Shane, my bad, I think I nuked some of your post! Luckily I quoted some of it.

Jools

[racoll]

I think we're getting a bit ahead of ourselves with this speculation about hybrids.

One step at a time. The first stage is to identify the maternal species with mtDNA, then once that is established, then investigate the possibility of hybridisation using DNA from the nucleus (biparental inheritance).

Unfortunately, having decent reference specimens is the limiting factor here.

[racoll]

a 10% difference in COI between two morphologically almost identical (and presumably closely related) species is surprisingly high.

I doubt that all brown Ancistrus share a common ancestor, but yes, it is a lot (actually 8.1% according to BOLD).

If anyone is interested, here's the common bristlenose sequence ...

>common_bristlenose
CTTTACCTAGTGTTTGGTGCCTGAGCCGGAATGGTTGGTACAGCCCTCAGTCTCTTAATTCG
AGCTGAGTTAAGCCAACCCGGTTCTCTATTAGGTGATGACCAGATTTATAATGTCATCGTTA
CCGCACATGCTTTCGTAATAATTTTCTTTATAGTCATGCCAATCATAATTGGGGGCTTTGGA
AATTGACTAGTTCCACTAATGATTGGGGCACCCGATATAGCCTTCCCACGAATAAATAACAT
GAGCTTCTGACTACTGCCCCCCTCATTCCTTCTTCTACTGGCCTCTTCAGGGGTTGAAGCGG
GAGCTGGGACAGGTTGAACTGTATACCCACCCCTCGCCGGAAACCTGGCCCACGCAGGAGCT
TCCGTTGACCTGACTATTTTTTCACTACACCTGGCTGGTGTTTCTTCAATTCTGGGGGCAAT
TAACTTCATTACCACAATCATTAACATAAAGCCCCCGGCTATTTCACAATACCAAACCCCCC
TATTTGTGTGAGCCGTACTTGTTACAGCGGTCCTACTCCTGCTTTCCTTGCCCGTTCTGGCC
GCCGGCATTACAATACTGCTCACAGATCGAAATCTAAACACCACATTCTTTGACCCTGCGGG
CGGTGGAGATCCTATCCTTTATCAACACTTA

[Jools]

I think we're getting a bit ahead of ourselves with this speculation about hybrids.

One step at a time. The first stage is to identify the maternal species with mtDNA, then once that is established, then investigate the possibility of hybridisation using DNA from the nucleus (biparental inheritance).

Unfortunately, having decent reference specimens is the limiting factor here.

Would sending fin clippings work? I would also suggest that we should have a wide international sampling of "the common

Ancistrus

?

Jools

[Mike_Noren]

Where was this particular common ancistrus bought?

[racoll]

Where was this particular common ancistrus bought?

LFS in New Zealand. The "L144" variety I collected had an identical haplotype to the common. Two albino bristlenose have also been sampled in South Africa, and are in BOLD. One was identical to mine, and the other has two mutations over 651 bp.

Here's the fish:

Would sending fin clippings work? I would also suggest that we should have a wide international sampling of "the common Ancistrus?

I was actually thinking about reference specimens of wild fish, but having said that, if hybridisation was more widespread than just a one-off event among common Ancistrus, then we would see multiple lineages. Sampling the trade would at least indicate that possibility, assuming introgression was not just from the male direction.

[Karsten S.]

Hi,

good to hear news on this topic. I always doubted the theory of the common bristlenose being a hybrid but also was quite sure that it's not A. cirrhosus but didn't have a clue what else it could be...

Again, as is stated several times on forums around the world, the only imported specimen of the true L144 was from Paraguay. Although it isn't documented that I'm aware of, the common belief is this fish was crossed back to the common strain to produce the blue eye gold strain now commonly sold as L144 and bred frequently with other strains of common.

Yes, the only L 144 (a male) was imported from Paraguay but the rest is not correct.
It was crossed back by Kerstin Holota with normally coloured specimen of the same shipment and already some of the first offspring were yellow. So apparently this female was the same species as the L 144 (as least to my knowledge xanthorism is recessive in bristlenoses). Sometimes you can read that the female was L 110/L 157 which is evidently wrong as those don't come from Paraguay. A much more plausible assumption is that L 144 is the same species as Ancistrus sp. "Rio Paraguay" as the normally coloured Ancistrus of this shipment were descibed as dark brown with reddish brown spots.

The "true" L 144 are not what is commonly sold as "L 144" (at least here in Germany) but the xanthoristic form of the common bristlenose. The latter ones have a much nicer yellow colour whereas the true L 144 are more "dirty" and paler, sometimes even kind of brownish. For that reason the true L 144 has disappeared or at least become very rare in the hobby. Some time back Ingo Seidel said in Switzerland there were still quite a few of them there and propably still are.

It is not suprising that your "L 144" has an identical haplotype as the common bristlenose as it's no L 144 but IMHO the xanthoriostic form of the common bristlenose.

I would also be very interesting to get also some L 144 and compare them to A. sp. "Rio Paraguay".

Cheers,

[Suckermouth]

It is not suprising that your "L 144" has an identical haplotype as the common bristlenose as it's no L 144 but IMHO the xanthoriostic form of the common bristlenose.

I'm just playing devil's advocate here, but the fact that the original L144 was male means that this is irrelevant. As mentioned earlier in the thread, mitochondrial genes are inherited maternally, and so if L144 was crossed to a female common bristlenose, then all the fry would have the common bristlenose haplotype.

[Mike_Noren]

I doubt that all brown Ancistrus share a common ancestor

I agree, "brown speckled" is probably the ancestral condition in Ancistrus, but the common ancistrus & cirrhatus have a fairly specific and unusual pigmentation pattern: small round light spots on the head which get progressively larger towards the posterior of the fish, ending in a complete or nearly complete transverse band just anterior of the caudal fin. I'm certainly no expert on Ancistrus but for what little it's worth I don't know any other Ancistrus with that pigmentation pattern.

[Jools]

I'd suggest that keeping a lot of things in mind in this debate might be more useful that just focusing on one element.

I always doubted the theory of the common bristlenose being a hybrid but also was quite sure that it's not A. cirrhosus but didn't have a clue what else it could be...

OK, so there are two things regarding hybrids I want to clear up. Firstly I am not saying every common Ancistrus out there is a hybrid but my opinion is that some or many are. Secondly, I am talking about the UK. Although my arguments for this position hold true internationally, I don't have any international evidence. So, if we're looking at fish in the US, New Zealand or elsewhere in Europe, then I don't know.

Finally, one thing useful to note would be the source of these fishes. Are the imported from wild or farms in these other places? I would be really interested in a confirm sighting of these fish that were WC. Rupert, what did your sampled fish come from?

Jools

[Karsten S.]

Hi,

I'm just playing devil's advocate here, but the fact that the original L144 was male means that this is irrelevant. As mentioned earlier in the thread, mitochondrial genes are inherited maternally, and so if L144 was crossed to a female common bristlenose, then all the fry would have the common bristlenose haplotype.

as stated above this is not the case.

Cheers,

[Janne]

The experience I have of the genus Ancistrus is, that they are very very stable and show very low variation in color and pattern over many generations, generation after generation look the same as the original couple... if wild cought. Similar looking species but different species of Ancistrus will crossbreed with each other, the more different they look the less likely they will crossbreed. "Common" Ancistrus is more variable and not at all as stable like wild caught relatives, they are also a large specie easily reaching 18-20cm TL in size (males, the Europe strain) and the most common variety. I do think there can be more than 1 common specie of common Ancistrus in Europe and also different species of common Ancistrus in US, in Asia I think it's the same "species" bred as czech republic and rest of Europe... it's not realistic to say there are no hybridization among common Ancistrus when it likely is the case.

Janne

[pleco_breeder]

The "true" L 144 are not what is commonly sold as "L 144" (at least here in Germany) but the xanthoristic form of the common bristlenose. The latter ones have a much nicer yellow colour whereas the true L 144 are more "dirty" and paler, sometimes even kind of brownish. For that reason the true L 144 has disappeared or at least become very rare in the hobby. Some time back Ingo Seidel said in Switzerland there were still quite a few of them there and propably still are.

For those who remember, the early released fish of the xanthoristic form of common had a very dirty pattern to it. A portion of their fry had light brown splotches which were often questioned about on the forums. I myself even had a few of these off colored specimens in my initial purchase of the strain. I never considered them unattractive, but simply had a different pattern similar to what is sold as a chocolate molly here in the US.

I suspect the trait was bred out for the more uniform gold since they did not match what most people were looking for in the strain. When looking at a fish which has been in the hobby for so long, it has to be assumed that specialist breeders are going to refine for the traits they want in their fry.

I would like to think I'm not the only person culling undesirable traits and cherry-picking from the remainder for the next generation. I do this with all my fish and consider it a part of being a responsible breeder. While I personally would not have bred the splotches out of the line, I wasn't a major producer of these fish and most of the information posted online at the time appeared that other hobbyists didn't like those "blemishes".

It would be interesting to see a comparison of the original L144 against the blue eye gold strain. It would definitely answer whether xanthic genes were introduced or was a random occurrence with very suspect timing.

Likewise, a comparison of Ancistrus sp. Paraguay could be very revealing.

Larry

[Suckermouth]

Hi,

I'm just playing devil's advocate here, but the fact that the original L144 was male means that this is irrelevant. As mentioned earlier in the thread, mitochondrial genes are inherited maternally, and so if L144 was crossed to a female common bristlenose, then all the fry would have the common bristlenose haplotype.

as stated above this is not the case.

Cheers,

My point was simply that if you are using racoll's genetic evidence to support your opinion, than that is a fallacy. The genetic evidence alone does not show that they aren't hybrids.

[Karsten S.]

Hi,

ok, now I got your point.
The usage of Racoll's evidence was not really meant to support my opinion.

The real L 144 were crossed back with wild specimen of the same shipment, this is a fact.

The commonly sold black-eyed yellow Ancistrus is very propably a xanthoristic strain of the common bristlenose, this is a widespread assumption that sounds plausible to me. The evidence of Racoll supports this but doesn't rule out all other possibilities.
I don't have any more information if or not there was a L 144 (male) crossed with common bristlenoses to get this trait but I never have heard about it before.

Concerning the mentionned dark blothes I also have observed these in the black-eyed yellow ancistrus several times, I would estimate in about 1-2% (out of some thousands offspring, see attachments).
But I didn't mean this when saying "dirty", in L 144 it is the yellow base colour itself which is often not so bright yellow.

Cheers,

[Shane]

On the other hand those believing that they are hybrids just state that it is their opinion. I would like to stay open minded, but there are a half dozen good points above pointing against these fish being hybrids and none so far pointing the other way.

In your open mindedness, you appear to miss the statement of fact that they will hybridise by the most experienced pleco breeder we have on the forum.

As to theories, well, here's a fact - I have not seen a picture of a wild caught common Ancistrus that I know is 100% wild caught within the past 15 years from any fairly well sampled area that looks like the fish we are discussing. That's 18,000 cat-elog images and quite a few books and LFS visits...

Does anyone have one?

Jools

[Jools]

I've done it again! What is going on - Shane - my public apology for nuking your post. I will need to stop replying to this thread...

Jools

[pleco_breeder]

Don't stop replying because this is turning out to be an interesting debate. Maybe start saying who you are before putting words in Shane's mouth.

On the other hand, this glitch could be the funniest thing ever if properly used

Larry

[Jools]

It's not a glitch, just me being an idiot. Twice.

Jools

[Shane]

You logged in as me with my username and password, deleted my posting, and replaced it with your own on accident... two days on a row? I can only guess that this is meant to be funny and I am just missing the punchline.
-Shane

[Jools]

You logged in as me with my username and password, deleted my posting, and replaced it with your own on accident... two days on a row? I can only guess that this is meant to be funny and I am just missing the punchline.

I can only apologise again and I understand why you think this is intentional. I think you also know my thoughts on deletion of any text submitted to the forum and I hope you can take my word for the fact it's accidental. I know it would be a hassle, but please do re-post if you can.

For the record, I am not logging in as you. I do not have access to any users password, they are not stored on the database. As you might expect, admins can use the forum with the effective permissions of any user, but I do not use this feature often (usually only for testing permissions). An admin has a button next to the quote button for editing any users posts directly. My fingers have now tapped that button incorrectly twice (actually I've done it several times over the years) and I've gone on with the edit. I have a significantly increased forum workload these days and I can only put it down to trying to do too much too quickly while my mind is focused on composing a well written reply.

Shall be more careful in future...

Jools

PS Sorry for cluttering the thread as well.

[Shane]

Jools,
Of course I take your word. I just could not figure out what was happening and the appearance (from my end) was that it was purposeful. Oh the joys of digital (mis)communication.
-Shane

[Jools]

Jools,
Of course I take your word. I just could not figure out what was happening and the appearance (from my end) was that it was purposeful. Oh the joys of digital (mis)communication.

Indeed. I have been VERY careful not to do it a third time. I reckon I've only done this a dozen times or so since 2003, so to do it twice on the same post to the same person was not ideal. Anyway, if it was purposeful it would be a lot worse.

Hopefully we can get on with the debate without further idiocy from me.

Jools